Saturn's Hexagon

[Addendum: About a day after writing this, it occurred to me that people might assume it is some sort of April Fool's joke. Amazingly it is not. However, I have managed to discover a more plausible explanation for Saturn's hexagon.]

Remember the Cassini probe to Saturn and its moon Titan? Well, it's still going strong. The above image shows a distinct hexagonal formation directly above Saturn's north pole. The shape is 15,000 miles wide (large enough to encompass nearly four Earths). Apparently the Voyager probes had detected it on their flybys in the 80s, but this is the first time that the entire hexagon has been captured in a single image. And it confirms that this is a real longterm (perhaps permanent) phenomenon. What I find interesting is that so far, scientists haven't put forth even the most tentative theory as to how such a structure could form or maintain itself. (Obviously it was built by intelligent Saturnians.)

Saturn's south pole has a radically different, yet no less dramatic, appearance. It actually looks to have a form more appropriate to Uranus.

Great Mysteries #3

A Couple of Physics Questions

I've got a couple of physics questions that have been bothering me for the past several years. The first concerns acceleration and the speed of light. While I understand that we can't currently build interstellar or intergalactic spaceships that can approach anywhere near the speed of light due to our being unable to produce sufficient energy over a sustained period of time, one thing I'm not clear on is whether manned spaceflight at near light speed would be impractical due to the effects of acceleration. In other words, assuming we did have a spaceship equipped with a powerful enough engine, if we stuck a crew of astronauts inside, set a course, and accelerated the ship continuously at 1 G, how long would it take for it to approach 90% of the speed of light? I've never taken physics, so I can't work it out on my own. As far as I know, it could take a week or it could take a thousand years. In the latter case, I think we can just give up on manned missions to other stars. Also, I should say that when I talk about time, I mean the time for the astronauts in the ship and not for outside observers still on Earth.

My second question concerns the fourth dimension. What I want to know is simply this: Is it or is it not time? I've heard convincing arguments for both sides. Some people say that it's not literally time. We only think of time as the fourth dimension because of the convention of using it as a fourth parameter to plot the location of a point in space. First you work out its spatial x, y, z coordinates and then use a fourth variable for time if it's not stationary. But I've also heard that just as a sphere is a two-dimensional plane curved in upon itself in the third dimension, so too is our three-dimensional universe curved into a sort of four-dimensional sphere. And spacetime does affect time, especially around black holes. So it would seem that the fourth dimension may actually be time. If this is the case, then I have additional questions:

  • Why four? Shouldn't time be the first dimension or the last dimension?
  • Would beings in a two-dimensional universe (flatlanders) not be able to experience time, since they are two dimensions away from it?
  • Is the fourth dimension the only non-spatial one, or are there a few higher dimensions that also specify some non-spatial attribute? Is there a dimension for chocolate?

Great Mysteries #2

What's up with helium balloons?

Helium balloons have puzzled me since I was a small child. I actually have several unanswered questions about them. First, I've never understood the concept of helium becoming "tired" and causing three-day-old balloons to start coming down off the ceiling. This is patently absurd. Helium molecules are lighter than the oxygen and nitrogen molecules. What would cause them to acquire extra mass? Yet balloons do seem to lose their rising power over time, even when tied with a firm knot and without diminishing in size. Even if the plastic had microscopic pores allowing the gas to gradually drain, this would still make the balloon observably smaller. When I was in second grade, my class released balloons with messages attached to see if anyone would find them and write back. We were to release them on a Friday, but due to rain, we had to postpone until the following Monday. My teacher expressed concern that the helium, still compressed in tanks, would lose freshness over the weekend and our balloons might fail to rise when they were filled on Monday. So apparently helium becomes tired even when stored under pressure. (Or maybe my teacher was an idiot.)

I'm also curious and have never encountered an answer as to what typically happens to a balloon after it is released. How high does it reach at its highest point? What causes it to descend? (Tired helium?) At first thought, I would expect the balloon to burst at some point as the outside pressure diminished. After all, if you thoroughly inflate a balloon at the bottom of a swimming pool and release it, it will pop before reaching the surface. But my impression is that balloons released outside eventually make their way back down to earth. Perhaps the plastic of the balloon exerts enough tension to keep the helium compressed even as the air outside becomes less dense until it reaches an altitude where it achieves neutral buoyancy and then just floats around until its helium gets tired. If it weren't for weary helium, the balloon should theoretically stay up there indefinitely (or even just stuck to the ceiling). What about hydrogen? Does it get tired too?

And for a related question, how come balloons attached to the wall with static electricity invariably come unstuck after a few minutes? Surely the electrons don't become tired and lose their negative charge. A more plausible explanation would be that the negative charge is gradually dissipated into the surrounding air. So would they stay up if they were in a vacuum? (Obviously the balloons would have to contain far less air.)

Also related, on Farscape Rigel farts helium whenever he becomes nervous. How is this possible? (Obviously it is, because he does it.) Helium is an element and a noble gas. The atoms don't bind to anything, so they can't be extracted through digestion from food molecules (since they never occur in molecules). Rigel's food and drink may be laced with large quantities of helium. This is not entirely implausible. After all, here on Earth we carbonate soft drinks with carbon dioxide; they may do something similar with helium elsewhere. But Rigel eats the same food as his companions, and you never see them farting helium. The only other possibility is that his digestive system can somehow transmute one element into another. But that would be as implausible as the ability to poop gold bricks.

Titan

The big news tonight is the Cassini probe landing on Titan. You can get up-to-date information here. Probably by the time you read this, it will already be there, and the first photos ever of Titan's surface will be available. Exciting stuff!

Solstice Hoax?

Motel_viewThe solstice is tonight. Kimberly came across this article in the Seattle Times stating that we will have the longest night for thousands of years. If true, this is extraordinary, but I couldn't find any other information about it anywhere on the internet. Could this be a solstice hoax?

Fucktard of the Week

Fucktard_scientist I subscribe to Discover and received the latest issue today with this delightful article. The kinds of animal experimentation that go on in the world are truly appalling, at least to me, especially when the experiments are done by doctors. This fellow is a neurologist, yet here he is blithely administering concussions to restrained rats. Would you want someone capable of that operating on your brain? I could go on and on about this, but really I just wanted to share the caption and photo.

Hobbits are Real!

Lately it seems I've had no shortage of blogging material. One very exciting development in my life is the birthday present my parents are sending me. (I'll be blogging about that later.) Even better news is the fact that michael is alive and blogging. But tonight I want to interrupt my regularly scheduled mediocre blogging (not that Michael is in any way mediocre), so I can be one of the first to talk about this, which I learned about from Receptionista.

Here's the gist of it. Thousands of years ago there were these teeny-tiny three-foot-high people who lived on an island. They were very smart, since they made tools and apparently some kind of boat to get out there in the first place. They lived in a magical world that they shared with tiny elephants and giant rats and fearsome komodo dragons. (Can you imagine being that tiny and sharing and island with these guys?) And then one day a volcano erupted, and they all died. (Well, at least we assume they all died.)

SETI Loves Me

Seti
It seems only yesterday that I completed 500 units. Now here I am at 1000 and still no alien signal.

Gonzo Science

I know finding great new music to download isn't anything new, but since I got my new iPod Mini, my interest in this practice has been revived. As I said before, I have made a few additions to my playlist, but finding an absolute gem is very hard. I'm not easy to please music-wise. I tend to like songs that are highly lyrical and a little bit silly. Yesterday, though, I came across a veritable treasure.

Here's how I found it. I was reading Bill's latest post, in which he offered a download to an obscure song that he believed was no longer available anywhere else online. A commenter replied with a link to a site that did, in fact, offer that song as well as the entire album which contained it. I checked out the site, and, on the off chance that they might have something else of interest to me, I scrolled down and checked out the other albums. That's how I discovered this.

Gonzo Science is the work of Jim Richardson and his brother Allen, both of whom believe that scientific orthodoxy unnecessarily holds back new ideas which may be valid. Each track of the CD is the defense of a theory not generally accepted in the mainstream of science. But it's also a song. You can play it and rock to a defense of the Aquatic Ape Theory or to a criticism of the Big Bang model of the Universe. And the music is good. You could easily include one or two tracks in a party mix without anyone thinking you're some sort of wackadoo. (Of course for me, it's a bit too late to be worrying about that.)

But what I really like about these guys is that they're not nutcases. I love non-conventional theories, as anyone who has been reading this blog for any amount of time can attest. The problem is that most people who defend such ideas are usually a little nutty. They have no concept of the scientific method and are willing to pretty much believe anything, and if no one believes them, they think there's some big conspiracy out there trying to suppress the truth. For example, Coast to Coast AM is a great radio show, but they take everything seriously, including ghosts, UFOs, alien abductions, governmental conspiracies, and the fact that one of their regular guests was incommunicado for a couple of weeks, because he was traveling through time.

The Allen brothers, on the other hand, have a much more critical eye for such theories. This is perhaps more apparent on their website entries than in their lyrics. They consider the existence of the Loch Ness Monster highly unlikely, and they also don't believe that the US government has secretly acquired extraterrestrial technology. Most of the ideas they defend are things that I agree with, many of which I have already blogged about, such as the Aquatic Ape Theory, and life on earth originating in space. (The Expanding Earth Theory was new to me, though.) For more information on their scientific philosophy, listen to the interview on NPR and check out Debunking the Skeptics.

Jungian Personality Typology (part III)

This will be the third and final installment analyzing my personality in terms of the INTJ type. Today I will be quoting and and commenting on passages from this description.

It is assumed that INTJs have no regard for authority when, in fact, what INTJs have is a lack of respect for authority that is not "learned" in ways that will benefit the system - a lack of respect for authority that is not "in the know", for INTJs respect knowledge above all and want only to deal with those who "know". Then, they are very capable students, co-operative co-workers and faithful disciples. They know, almost as no other type knows, that a "weak" head means a weak system and work will be in vain. Wasted time, effort and energy are terms for failure to INTJs and INTJs do not like to fail.
Wow. I could write an entire post about this one point alone. I do have a great deal of respect for authority, but a lot of my past bosses and teachers might take issue to that statement. Some people just can't understand that, when I am complaining about something they do (or don't do) or when I suggest another way of doing something, it is not personal. I'm not trying to be difficult or challenge anyone's authority, and I'm definitely not trying to find ways of getting out of work; I'm trying to make everything run as smoothly as possible for everyone (including the boss), and I happen to be aware of a huge obstacle preventing that, usually one that could easily be removed.
INTJs do not need to be the centre of attention and, though they may be extremely critical of others' ideas, they, nonetheless, will work to bring about the dreams and schemes of those they care about once their (the INTJs) views have been made known. Often the point is missed that INTJs often employ debate but are quick to recognize a higher truth, though they will debate until truth arises or someone "quits".
This is also very apropos to my life. Often someone will make a statement that I disagree with or that isn't convincing. So I say why I disagree, and we go back and forth. Quite often, people think I'm fighting with them. To me, though, it doesn't even qualify as a debate, since my interest is not so much in convincing them that I am right as it is to work out what the truth is. I would be more pleased to find out they they are right, because then I would be learning something about which I was previously mistaken, and I usually take it for granted that they feel the same way. I don't see why everything has to be taken personally.
INTJs are born executives and are totally dependable and dedicated to any project to which they commit themselves. They are unstinting in perseverance, intolerant of weakness and demanding of any under their authority. While being great taskmasters, they are nonetheless unstinting in seeing that due credit is given to those who deserve it and are not grasping for honours for themselves. They only truly appreciate praise when it is really deserved or comes from those whom they admire and are in a position to truly know that the praise is really deserved for perfection is their standard.
That's true. People see me as very demanding, but they usually go along with me, because they can see that I hold myself to the same standards. And I don't really appreciate praise unless it is sincere and deserved. In other words, I find it annoying to be praised just because the boss wants to be polite or encouraging. Also, I am very aware that the success of any group endeavor is determined by its members, even if I am the one in charge. If a project is a success, I am always extremely grateful and make sure to richly reward them at the end.

Jungian Personality Typology (part II)

This is a continuation of yesterday's post, in which I took an online personality test and determined that I have an Introverted Intuitive Thinking Judging (INTJ) personality. Today I will comment on the result and how I see it applying to me. To do this I will draw on and quote sections of the description of the INTJ personality (also called the "Mastermind" personality) found here. Off we go.

[INTJ personalities] are rather rare, comprising no more than, say, one percent of the population.
This comes as no surprise to me. I almost never encounter a person with a similar thought process to mine. Years ago, and without the aid of a test, I determined that I was probably a Thinking-Intuitive type, but I had my doubts, because thinking and intuition are opposites according to Jung. You can think of the four modes (thinking/feeling/intuition/sensation) arranged in a circle. Nearly always, a person's secondary mode is one of the two next to the primary and not the one opposite it. In other words, each one has two complements and an opposite. Since opposites are mutually opposed to each other, they make for a highly unlikely synthesis, hence the rarity and weirdness. So the pairing of thinking and intuition did not come as a big surprise to me, but I didn't expect to see intuition as the primary mode for me. In my youth, I was almost all thought, but I suppose I have been thinking progressively less over the past several years.
Natural leaders, Masterminds are not at all eager to take command of projects or groups, preferring to stay in the background until others demonstrate their inability to lead.
It's amazing how spot-on this description is. I do see myself as a good and competent leader, and I enjoy being in charge of projects involving other people. But I rarely try to assert myself into such a position, because then it just becomes about politics and status. I also feel that here in the US, leadership ability is elevated to an absurd level and seen as a prerequisite for success. It's really hard to get anything done in an informal group situation, because there are always those who feel that they should be the leader. My philosophy is that anyone who truly wants to become a great leader must first master the art of following, which is no less challenging an endeavor.
To the Mastermind, organizational structure and operational procedures are never arbitrary, never set in concrete, but are quite malleable and can be changed, improved, streamlined.
Yes, but I would add that it's very imporant to familiarize yourself with rules, laws, and procedure. Most people either disregard such things or memorize them so they can follow them to the letter. I familiarize myself with them, so I can learn from them and decide whether or not to obey and why. It's also useful to know when you are breaking a rule. In short, I always take the time to learn the rules, but that doesn't mean I will obey them. On the other hand, I never disobey without a very good reason (to me at least).
. . . it is the contingency planning or entailment organizing role that reaches the highest development in Masterminds. Entailing or contingency planning is not an informative activity, rather it is a directive one in which the planner tells others what to do and in what order to do it.
What's interesting about this description is that it assumes that these abilities are always used in leadership positions. I'm very good at this sort of planning, but it's almost always done on a personal level. Every important life decision I make goes through a complex process of weighing the options, looking at possible outcomes, and searching for convergent opportunities. People, as a rule, can't understand why I make the decisions I do and often conclude that I must just be insane. But if I have the time, and someone is generally interested, I can sit down with them for an hour or so and explain my reasoning behind a decision, what I hope to accomplish by it, and why I chose it in lieu of far more (seemingly) reasonable options. The person may ultimately not agree with the decision, but they will understand it and see that it makes sense. What I've found to be true in recent years is that complexity breeds further complexity. Every time I do something for complex reasons, it inevitably adds an additional layer of complexity to future decisions, making my life progressively more complex, which to me is fun.
In their drive for efficient action, Masterminds are the most open-minded of all the types. No idea is too far-fetched to be entertained-if it is useful. Masterminds are natural brainstormers, always open to new concepts and, in fact, aggressively seeking them.
I'm definitely open-minded. I can always entertain possibilities without needing to be certain they are true. I don't think I would be a very good juror, though, since, to convict, you have to be certain beyond a reasonable doubt that the defendant is guilty. To me, if someone is on trial and argues that they are innocent, that in itself would cause me to have a reasonable doubt. I'm very good at switching back and forth in conversation between the rational (things that are known to be likely and pass the test of the scientific method) and the non-rational (matters of religion, conspiracy theories, and crackpot science). Both have their place, but a lot of people don't see it that way. They either automatically discount anything that hasn't been or can't be proven scientifically, or they are capable of believing just about anything and have no conception of what science is. That's the reason I was so distraught over that quiz I took some time back (I don't remember the URL.) in which belief in the Loch Ness Monster was treated the same as belief in the existence of God. To me those are both valid beliefs, but they fall into completely separate categories (science and religion).

I hope you've enjoyed learning about me, but I fear I may need to do a part III.

Jungian Personality Typology

Certain people have been complaining that the "About Me" section of this blog is woefully inadequate. Someday I really must develop it a bit more. In the meantime, I've decided to share a bit more about myself via the results of this online personality quiz. It's not just another one of those silly quizilla things; it's the real deal.

It's based on the theory of personality types worked out by C. G. Jung. I was really into Jung years ago. It's probably not an exageration to say that his writings changed my life, so I was really excited to find this test. Although Jung developed the theory, he never formulated an actual test. He simply got to know his patients through analysis and learned to spot the different types.

Here's how it works. There are four basic psychological modes humans use to relate to others and their environment: thinking, feeling, sensation, and intuition. Everyone draws on all four to some degree, but different individuals have them developed to different degrees. Everyone has a primary one, which is the most developed, and a secondary one, which supplements the first but is not as developed. The other two are often barely developed or drawn upon at all.

People whose primary mode is thinking are extremely rational. They use logic and do things that make sense and can be explained. They think things through and are very good at spotting inconsistencies.

Feeling people tend to go with their gut. They avoid doing things that just don't feel right, and they often judge people based on a feeling. Things are seen as fitting somewhere on a scale between very bad and very good.

Sensation emphasizes perception. People in this category are the ones who like to say that "seeing is believing". Most of the information they draw upon comes from firsthand observations. These are not people who rely much on books to teach them about the world

Those who are intuitive are fairly confident that they know how the world works. They have a framework built up in their minds, and anything they experience is seen as fitting into that framework. Their actions and important decisions are dictated far more by what fits in their worldview than by logic, and a great deal of it is subconscious.

You may want to look up other descriptions of these four functions. I find that different people have radically differing ways of describing them. Generally, a person will speak highly of the functions that are dominant for them and disparagingly of the ones which are least developed in them, usually without even being aware that they are doing this. I met one woman who, in a presentation, was going over the strengths of each one, and she had a heck of a time thinking of even a single good thing to say about people who are thinkers. That really blew my mind, especially since the point is that none is superior to any of the others. Ideally we should try to develop each one as much as possible, so they can compliment one another.

In addition to the four functions, most people can be classified as either mainly introverted or mainly extroverted. (Jung is the one who invented those terms.) Extroverts are mostly preoccupied with things and people in the external world. Introverts are more internal. Once again, they are not mutually exclusive, but most people tend to be much more one than the other. (Introverts are probably much more interested iin taking this test than extroverts.)

This test also adds a distinction between judging and perceiving. These aren't Jungian distinctions, and I'm not certain I understand them, so I won't attempt to explain them.

My test results are posted at the top of this entry. Tomorrow I will write about what they say about me. In the meantime, I invite you to go take the test and find out just what kind of person you are.

Prosopagnosia

I've often wondered how it is that a person can reach adulthood having lived all their life with some sort of serious shortcoming in the way they are wired without ever being fully aware of it. Color blindness is an example. How a can a person with even a partial inability to distinguish colors grow up with realizing this? One would expect that for a person who could not tell the difference between red and green, it would not be much of a leap for them to to see that they had a problem. Certainly there would be no shortage of amusing incidents in their lives to drive home this point.

I may not be color blind, but it was only a few years ago that I realized I have another sort of neurological problem that is probably just as debilitating. I was reading the introduction to Jane Goodall's Reason for Hope in which she mentions that she suffers from a neurological problema called prosopagnosia. (The text is available here.)Basically this is a shortcoming in the brain's ability to recognize and differentiate human faces.

The funny thing is that until I read that, I had never realized there was something wrong with me. But once I learned that such a problem existed, I immediately recalled dozens of incidents in my life that should have clued me in to the fact that something was not normal. There are lots of horribly embarassing stories I could tell at this point, but for the sake of my self-esteem, I'll just mention one. When I was in high school, I called a girl up, asked her out, picked her up, and took her out to dinner and a movie. The next Monday at school I passed her on the stairs. She was looking directly at me, so I looked back. Then I continued on, having no idea who she was. She never really spoke to me again after that. Clearly this was one of many points in my life when I should have realized there was something not quite right about me.

A more typical incident which occurred a few weeks ago will better illustrate my day-to-day difficulties. One day I was coming out of a classroom, as were a horde of other students. Just then I heard a female voice say "hi" followed by what sounded like my name. I turned my head in the general direction of the voice and saw a crowd of people, none of which I recognized. Of course by then the speaker had finished speaking, so it was too late to spot the mouth as it uttered the words directed at me. There was one friendly female face looking directly at me. I did not recognize her, and it didn't help that she was wearing a hat. But was she the one who had said hello, or was she just looking back at me, because she saw me looking at her? Had anyone actually spoken to me? (After all, there was a lot of background noise.) I stared at her, and she stared at me. Then I kind of squinted so I could scrutinize her features in great detail. When I did this, she visibly recoiled. But was she recoiling because some guy she didn't know had looked at her in a friendly manner as she walked down a corridor looking as if he was going to say something to her but instead, started staring at her face very intently? Or did she recoil because she knew me, had said hi, saw me look back at her, and instead of a greeting in return, all she got was a prolonged intense stare? I wish I knew. I also wish I knew who the heck that was. That is a fairly typical event in my daily life.

As I stated previously, prosopagnosia occurs at various levels of severity. I am lucky enough to still have some facial recognition ability. Apparently there are people who have none at all. There is a great page that explains facial recognition ability in terms of recognizing stones in various contexts. It gives a very accurate portrayal of the types of situations in which I often find myself when I can't instantly pick out a face.

During my research for this post, I made an exciting discovery, which is that people with prosopagnosia are also often afflicted with topographic agnosia, which means they have no innate sense of direction. That's me alright. It was a relief to discover that the two conditions are probably manifestations of the same cause. In other words, there is really only one thing seriously wrong with my brain, not two. I may even have a very minor case of Central Auditory Processing Disorder. Apparently it's all one great package deal.

Cockroaches Are Our Friends

This is the kind of stuff I find really interesting. In 1999 the New York Times Magazine ran a contest for the best idea for a time capsule that could store all the existing content published so far by said magazine and have it be preserved for at least a century. Jaron Lanier (who's no crackpot) proposed that the data be digitized and then stored in the DNA of cockroaches. Oblivio has summarized the process excellently. (That man knows how to write.) Lanier's original proposal is no longer online, but you can still read the archived version, appropriately enough, through archive.org.

I'm sold! This is a great idea. The concept has been around for years in science fiction (mostly notably in a 1993 episode of Star Trek TNG, but I didn't know it was actually feasible in the near future or that in could be done safely. When Lanier proposed the idea in 1999, the technology was still out of reach, but he correctly foresaw that it soon would be. Today the only thing that is lacking is a sequencing of the cockroach genome. However, it would be feasible and affordable to store information in the human genome if we were so inclined.

The New York Times Magazine would not be at the top of my list of things to preserve for posterity, but there are plenty of other applications. Since we're now living in what will come to be known as the Digital Dark Ages, this may turn out to be an effective way of preserving some of the more essential information. Also, if civilization comes to an end through nuclear war or unstoppable nanobots or some such thing, it would be nice to have an additional way of of sending the information to our descendants. We may also want to poke around a bit in the various genomes to see if anyone (Atlanteans, aliens, time travelers, God, etc.) has sent us any cool messages.

DNA is a neat storage medium, because each bit can hold four values, as opposed to only two in binary. So if I wanted to encode "tvindy" in binary, it would look like this:

011101000111011001101001011011100110010001111001

Whereas a possible DNA encoding would look like this:

TCTATCTGTGGTTGCGTGTATCGT

I used the following encoding scheme:

00 = adenine-thymine = A
01 = thymine-adenine = T
10 = guanine-cytosine = G
11 = cytosine-guanine = C

Anyway, the point is that the binary sequence is 48 bits long, and the corresponding DNA sequence is only 24 bits long. Cool huh?

Oh, and the cockroach picture is the work of David Kha.

Mars Cats

I stumbled onto this by chance yesterday in the checkout line at Target. It's truly amazing how things like this don't make it into mainstream news. As usual, NASA tries to downplay everything. One official was even quoted as saying, "It's frustrating to have to answer questions about this nonsense when we're making such exciting real discoveries on Mars."

The martian felines look a lot like cornish rexes, but they must have totally different physiologies to be able to exist in such a cold climate with absolutely no oxygen in the atmosphere. Cats on earth are desert-adapted. That's why the feral cat population in Australia has been so successful. But these cats could conceivably be used to populate Antarctica and rid us of that pesky penguin infestation.

I remember reading the famous Space Cat novels as a child. In Space Cat Meets Mars, Space Cat actually encounters another cat on Mars, and she turns out to be genetically compatible with him, because in the next book, they have kittens together. I thought that was all a bit farfetched, but it seems I was mistaken.

SETI

I first downloaded the SETI screensaver when it became available in May 1998. Early this morning my computer finished processing my five hundredth work unit. According to SETI, I have completed more work units than 92.6% of their other users. The ETs have yet to be found, but I sure they'll show up by the time I've completed my one thousandth work unit.

Extraterrestrials

Are there extraterrestrials out there sharing the galaxy with us, and have they visited our planet? Are they perhaps visiting it now? Who knows? I know I don't. But here are some interesting facts to consider when pondering such questions.

The galaxy is probably not brimming with life, at least not planets to which the life is indigenous. Unfortunately we don't have a large sample of life-producing planets from which to extrapolate. Earth is the only one we know of with any degree of certainty, but it has a number of features that make it very unique, which would indicate that it is unlikely that ecosystems comprised of complex multicellular life forms can arise on most planets.

First of all, our solar system is located far out toward the edge of a spiral arm of the galaxy. By being so far out of the way, we are exposed to a lot less clutter than the vast majority of other star systems. This means that we get fewer strikes from asteroids and comets, which are notorious for causing mass extinctions. An unlucky collision from a large enough body could conceivably wipe out all life on the planet.

Furthermore, earth is the only planet in the solar system to rotate around the sun in an almost perfect circular path. The other eight planets all have eliptical orbits, which play a huge rĂ´le in determining their weather patterns. As the planet gets farther from the sun, it gets colder; as it gets nearer, it warms up. On earth, climate change tends to be much less severe and is determined by the earth having a tilted axis. The less drastic the seasonal changes, the less stress there is to the ecosystem. Circular orbits may be very uncommon for planets; they certainly are not the rule.

Add to this the fact that our moon is also essential for regulating our climate. Without its stabilizing gravitational influence, earth's axis would not only be far more tilted than it is; it would wobble all over the place. There would be occasions when Antarctica would lie on the equator and be a tropical continent. Hawaii could just as easily find itself at one of the poles. The moon's gravity also helps to deflect the paths of approaching asteroids away from the earth. We are very fortunate to have the moon, but the prevailing theory on its origin says that for the earth to have a moon of that size, something very unlikely had to have occurred. During the formation of the planets through regular collisions of material around the sun, our earth and moon were formed when two planet-sized bodies collided, merged, and then split apart. If the collision had been any weaker, they would have merged, forming one large planet. If the collision had been stronger, the moon would have been expelled with too much force to be caught by the earth's gravity and would have gone on its merry way.

If the emergence of complex life were a common occurrence throughout the galaxy, it is highly unlikely that we would find ourselves living on a planet with so many unlikely advantages. That's a depressing notion for people like myself who keeping hoping that any day now the aliens will pop in for a visit. However, there are some reasons to believe that they may be out there.

First of all, even if the emergence of simple lone-celled life forms is rare, over millions of years it is probably common for microbes to travel from one planet to another. All that is needed is for a large enough asteroid impact to throw rock and dirt and ice up into space. Occasionally some of the larger chunks may find their way into the atmosphere of another planet. If just one or two organisms thaw out and survive and can find enough nutrients to keep themselves going, eventually they will probably adapt to the new environment and spread all over the place. Some people have suggested that the fossilized Martian microbes (assuming that's what they are) may be descended from earth microbes or even that the reverse may be true -- life may have begun on mars and traveled to earth. I don't find it at all unlikely that when we eventually take samples from the gas giants, we will find their atmospheres full of bacteria. And over billions of years, there is no reason life wouldn't be able to make it to planets in other star systems.

Of course none of that makes much of a difference if there aren't any planets out there that can nurture the microbes sufficiently to allow them to go multicellular. But we really only need a few good planets out of the billions in the galaxy where this can occur. Of course this would probably put the ETs thousands of light years away from us. It would be hard for contact to occur in that case. But I will always remember something that Carl Sagan said in his Cosmos television series. According to him, based on what we know about the galaxy and physics, if a spacefaring race of beings were to set out from its home planet to colonize a world in another nearby star system at conventional sublight speed, and if each settled world eventually sent out more ships, there would be a geometric progression of settlement and exploration. In just a quarter of a million years, the aliens would have visited, and possibly settled every starsystem in the galaxy. A quarter of a million years is nothing! The earth is billions of years old. The dinosaurs went extinct 65 million years ago -- that is 260 quarter million year periods.

So if such civilizations do occasionally arise, then it is almost a certainty that the earth has been visited multiple times. Considering how rare the earth is in terms of the features listed above, one would think that the aliens would take a huge interest in it. After all, among billions of worlds in the galaxy, ours may be one of only a handful on which a complex ecosystem arose. One would think that our planet is under constant observation. Even if the aliens have no interest in making contact at this time (probably for our own good), it's highly likely that they are out there and that we are well known to them.

I find the reports of UFO encounters over nuclear weapons facilities to be intriguing, given that the aliens' most serious concern would be that humans might wipe out all life on the planet. It is comforting to think that they may be out there, unwilling to make themselves known but ready to intervene to save us (or at least our environment) from ourselves.

Foreign Language Study and Literature

I've taken a multitude of undergraduate foreign language courses, and one thing that has always bothered me about the way that they are taught is the great emphasis that is placed on literature classes as a major prerequisite to obtaining a degree. Don't get me wrong. I understand the importance of students being exposed to the literature of the countries whose language they are studying. This is necessary for learning about the culture as well as reading practice. The problem is that literature requirements are so extensive that they impede the learning of grammar.

At the graduate level the situation is somewhat different, but for undergraduates I believe the emphasis should be placed primarily on mastering the language. At my local university, this is done only for the first two years of language study in classes numbered 101, 102, 201 and 202. Once into the the third year, the only options for continued study of the actual language (as opposed to literature and culture) are a grammar, composition, and phonetics course. That's it -- just three classes. And since many students test into the upper level courses, they receive very little grammar background at the university level. Although the advanced courses are taught in the language of study, and papers are assigned to be written in that language, that is simply not enough. It is not uncommon in 400-level classes to observe students making mistakes in very basic grammar or pronunciation, misconjugating to verb to be, for example.

Here is what I suggest as a more appropriate curriculum. First, the first four years of study should be dedicated to the language itself. That means that instead of going from 101 to 202, there would be a continuity of study going all the way through 402. In other words, there would be eight semesters of basic language study rather than four. This would not lengthen the time to achieve a degree, since once a student has completed 202, she is still eligible to take the more advanced classes.

Second, there would be an overall decrease in the number of required literature courses. The 301-402 classes would replace four of them.

Third, one of the literature classes would be devoted to thoroughly modern material. One possibility would be a class focusing on the ten bestselling books of the last decade in France (or any appropriate country). As it stands now, students can complete a language degree without the slightest familiarity with the material currently being read in their language of study. They should have at least a sense of this. Furthermore, modern writings are much easier to read and understand, and since it is the modern form of the language that is being taught, it makes sense to start the students' introduction to reading with something more representative of their studies. A logical first step to attaining a level of reading proficiency suitable for reading the great works of literature in a foreign language would be to start with a mastery of the ability to read modern texts.

Finally, professors should remember that the vast majority of undergraduate students go into language study for reasons other than to become familiar with great works of literature. This should go without saying, but my impression is that many professors do not realize this. Most students are interested in basic mastery of the language. They want to be able to speak, read, and write in it. Often they are trying to make themselves more marketable to prospective employers, in which case literary study is irrelevant.

Certainly there is a place for literature in undergraduate degree courses. I am not arguing against this, but I do believe that they need to be deemphasized. Students wishing to pursue foreign language literature at a deeper level can always do this at the Masters level. And for those who do, it would certainly behoove them to have had a more solid grounding in the fundamentals at the undergraduate level.

Prime Number Generator

A couple years back I wrote a C++ program that generated a list of all the prime numbers up to a specified maximum. I was hoping to dredge up the code for it and post it here, but alas, it seems to have vanished from my hard drive, and I no longer have the knowledge to write such code. For computer science people, such a program would be child's play, but it was a challenge for me. Since I can't reproduce the code, I'll just describe the process I devised, which not only calculated the primes but did it in what I think was the most efficient way possible.

First the program asked for a maximum value -- the point above which the program would stop checking for primes and terminate. The higher the number, the longer the program would run. The program would then test a sequence of numbers, starting with 3. (1 was skipped, and 2 was a given.) The easiest way to check to see if a number is a prime (in terms of ease of coding) is to check every positive whole number (except for 1) below its value to see if any are divisors. If not, then you have a prime. That works, but the process is much slower than it needs to be. I gradually worked out what I believe to be the fewest number of division tests necessary.

First of all, I reasoned that I would not have to check beyond values that were more than one half the number, since such values multiplied by 2 (the lowest possible divisor) would exceed the given value. Okay, then what about one third? In that case, as long as I checked for 3 as a divisor, then anything above one third could be skipped. Following this logic to its inevitable conclusion, I finally realized that it would never be necessary to check for any divisor greater than the value's square root, because obviously if the square root were multiplied by a value greater than itself, its product would have to be greater than the value being tested. Once again, any mathematician could probably tell you this off the top of her head, but I'm no mathematician, and I worked it out for myself. So I'm moderately proud of myself.

But that's not all. It is possible to further reduce the number of tests by only testing primes as divisors. After all, any non-prime number can be factored into primes, so it is redundant to check with non-primes. Now we have an interesting situation. Since the purpose of the program is determine which numbers below a certain value are primes, it would be silly to embed a list of primes into the program. That would totally defeat the purpose. (Although one might argue that it would make sense to include a short sequence of the smallest primes to speed thing up.) My solution was to use the primes as they were determined by the program. In other words, instead of just printing a number on the screen as soon as it was determined to be a prime, I had the program store it in an array (a list of values) to which it could refer.

Here is what the program did:

  1. Take a value (starting with 3).
  2. Determine that number's square root.
  3. If the square root is not a whole number, round it down to the nearest whole number.
  4. Refer back to the list of prime numbers which have already been determined. (2 is there by default.)
  5. Take each prime number that is less than or equal to the rounded down square root of the value being tested and see if it is a divisor of that number. In other words, can it be divided into that number without there being a remainder.
  6. If there is no remainder [for one of the divisors], then that value is [not] a prime number, and it is [not] added to the array. No further tests are made of it.
  7. If all possible tests have been done, and all the divisors result in a remainder then the value is not a prime number and is not added to the array.
  8. Increment the value by one.
  9. If the value is greater than the stated maximum for this run of the program, print the array to the screen and/or a file, and terminate the program. Otherwise go to step 2.

Now wasn't that incredibly interesting? (I know it wasn't, but if I can't blather on occasionally in my own blog, where can I?) In any case, if anyone out there actually read this and knows of any further ways the process of finding primes can be streamlined, I would be thrilled to hear from them.

Calculus

As I've stated previously in this blog, on two occasions I attempted to earn a degree in computer science and ultimately failed. The largest stumbling block for me was calculus (although all the introductory classes were challenging). The following paragraph is taken from the introduction to the 1998 version of the book Calculus Made Easy.

Introductory courses in calculus are now routinely taught to high school students and college freshmen. For students who hope to become mathematicians or to enter professions that require a knowledge of calculus, such courses are the highest hurdle they have to jump. Studies show that almost half of college freshmen who take a course in calculus fail to pass. Those who fail almost always abandon plans to major in mathematics, physics, or engineering -- three fields where advanced calculus is essential. They may even decide against entering such professions as architecture, the behavioral sciences, or the social sciences (especially economics) where calculus can be useful. They exit what they fear will be too difficult a road to consider careers where entrance roads are easier.
It was nice to find out that my situation is common. I'm also proud to say that, after failing calculus the first time, I did not give up. I took it a second time and failed again. Besides the fact that the subject is so difficult, there were two other factors that made things difficult for me. The first was that, unlike the majority of the other students who were taking it as a means to achieve high-paying careers, I was actually interested in the subject matter. Most of the other students were not really interested in the math itself, and the teachers did not even make a pretense of presenting it in an interesting way. It was an extremely joyless environment.

Also, computer science, as well as most areas that require a knowledge of calculus, are extremely competitive. The introductory calculus classes seemd to be set up as a way of weeding out the weaker students before they advanced further into their respective programs. Classes were frequently scheduled at 8 am to lower attendance, and in one of the classes, there were simply more students than desks. After a few weeks when enough students had dropped out, there were finally enough desks for everyone. I really felt uneasy with that atmosphere in which everyone was seen as expendable. Considering how much tuition costs nowadays, I question the ethics of treating students that way.

Eventually I went back to languages and finished my major in French. Language students are so much happier. They are not there for the promise of getting a prestigious job; they are interested in the subject matter. And the teachers do their best to help and maintain their students. (Sometimes they make things a little too easy for the students, but that is another post.)

Of course I have to take some responsibility for my failure. After all, many students just breeze through calculus with very little trouble. And even in an ideal learning environment, I may very well still have failed. Calculus is extremely difficult for me. I haven't given up, though. Someday I will go back and master calculus. But for now I'm taking a decade-long break from it.

Infinity

Well, this is the day of the week when I publish some old work of mine. Lately I seem to be scraping the bottom of the barrel. There's just not much material left in this category, but I have a metaphorical spatula, and there's still a little bit of crap way down at the bottom. After all, there's no sense throwing out a barrel until it's completely cleaned out.

A few years back during one of my futile attempts to get a degree in Computer Science, I took a class called Discrete Structures. (I never did find out what that term meant.) One of the assignments given to us was a workbook exercise that asked us to define a set with an infinite number of elements. Each element had to be a pair of values, and one of them (but only one) had to contain the same value for both elements. I did it wrong.

I defined the first element as containing zero and infinity, respectively, with each subsequent element incremented by +1 and -1, respectively. So the second element would be (1, (infinity-1)). I defined the final element to contain infinity and zero, respectively. Going backwards, it would be incremented by -1 and +1 respectively. Based on my logic, there would be an infinite number of elements in the set between the two endpoints, since that's how many it takes to get from 0 to infinity, counting by ones, and vice versa. At some theoretical midpoint between infinity and zero, the two values would be the same.

But as I said, this was wrong. The professor explained to me that you can subtract any finite value from infinity, and by definition you still have infinity. That makes sense, because otherwise the value could not have been infinite to begin with. But it makes equal sense that if one subtracts 1 from infinity an infinite number of times, one would get zero. After all, infinity minus infinity must equal zero.

I found this situation extremely interesting, because on the surface it would appear to be just another one of those insoluble philosophical conundrums, where you have two mutually exclusive answers, but neither can be excluded. (i.e. Could God make a rock so large he couldn't lift it?) But I also accept that the professor knew what he was talking about but couldn't explain it without getting into mathematics that were beyond me. I'm in awe of the fact that such things can be grasped by the human mind using higher mathematics, and before I die I will at least master Calculus. (Although it may take me 20 years.)

Response to Comments on Yesterday's Post about "The Origin of Consciousness in the Breakdown of the Bicameral Mind"

I got some really interesting and insightful comments on yesterday's post. Since they require a lot of thought, I'll just respond to them in today's entry.

To Geoff: One problem I had summarizing the book was its use of the term consciousness. The book goes into it in great detail and describes various theories about it, but I couldn't get into all that in a brief post. Consciousness has a lot of definitions and means different things to different people. To my mind, no modern humans possess a fully conscious mind in the sense that so much of what we do is instinctive and not thought out. My impression is that there is a lot of stuff going on behind the scenes in my head that is completely hidden from me. But that's probably not what you meant by the term. For me, the difference between the consciousness of people today and thousands of years ago is a matter of degree.

The author also brings up the point that there is a detectable difference in the physical structure of the brains of schizophrenics. He speculates that the brain is so plastic that a young child brought up in a bicameral society might actually have the anatomy of his brain develop a little differently physically. (And of course that brings up the point that if that is so, what other configurations might be possible?) The issue of consciousness aside, the idea of being guided by hallucinations is intriguing, especially since early religions tended to describe constant direct contact with gods and ancestors, and then later religions portrayed the gods as being more removed and obscure.

You raise a good point about the Greeks describing themselves in terms of their beliefs. After all, the Iliad and Odyssey were epic poems and not documentaries. But it is interesting how much of those works revolves around gods appearing to individuals (never to groups) and telling people what to do. The author also suggests that muses were not just a symbol for literary inspiration; writers actually heard them and wrote down what they said. I don't have much of a classical education, so I can't really judge how different they were, but I remember reading more than once in the writings of C. G. Jung the idea that the ancient Greeks were actually far stranger and more alien in their thinking than most scholars are aware.

To Crawford Kilian: Thanks for the book recommendation (The User Illusion: Cutting Consciousness Down to Size). I've never read it, but I have read Consciousness Explained by Daniel Dennett, which seems similar. Instead of the veto concept, it deals with the bubbling-up theory which says that the subconscious is always releasing a myriad of tiny bubbles. The strongest ones grow and make it to the top (consciousness).

To Widdershins: That is an interesting idea. Whether or not that's true literally, what I've always found interesting about mind-altering drugs is that they cause a person's thought processes to work a little differently. Whether we like to admit it or not, we are all in a mental rut, constantly filtering everything through tried-and-true thought processes that are familiar to us. Once when I was in Amsterdam I tried some mushrooms, and was amazed how differently my mind started working. My thinking didn't appear to be less coherent, but it was very different, as if I was thinking with someone else's brain. I don't really advocate drug use, but I have to say that the experience did help to broaden my thought process by forcing me to think differently for a short period.

To Michael: Thank you for sharing that. I've never had more than brief encounters with people who are schizophrenic. I don't doubt that life must be very hard for them. Most people tend not to associate with people they see as different or can't understand. And a lot of people are easily freaked out. I've heard that in some tribal societies schizophrenics are venerated as having spiritual powers.

Thanks to all who left comments. (I love getting comments.) I'm not sure I believe the whole bicameral theory, but I find it very appealing. One thing I am fairly certain of is that there was some really weird stuff going on with people thousands of years ago. If nothing else, this book provides further evidence of that fact.

The Origin of Consciousness in the Breakdown of the Bicameral Mind

It seems I've been writing a lot lately about interesting theories on human evolution. Here is another one. Several years ago I read a book entitled The Origin of Consciousness in the Breakdown of the Bicameral Mind. It's worth reading just to be able to brag about having read a book with such an impressive title.

The author, Julian Jaynes, has an interesting hypothesis on the origin of modern consciousness. He believes that soon after acquiring language, human beings began to hallucinate. Back then, most of our intelligent thought took place in the subconscious. It probably still does today in the sense that we can be guided by our dreams or by sudden insights that appear from nowhere. But early man had far less awareness of his thought processes. According to Jaynes, once language had been developed, the subconscious used this ability to communicate directly with the conscious mind. In other words, people experienced auditory hallucinations that guided them by compelling them to act in certain ways. Through the development of religion, these voices came to be regarded as messages from the gods and the dead. It is very interesting to go back and reread the Iliad or Odyssey from this perspective, seeing the constant visitations from the gods as a neurological phenomenon.

This theory sees schizophrenia as a kind of throwback to that earlier mental state. In both cases, people hear voices which are so compelling and full of authority that they often cannot resist, even if they are told to do something terrible. The problem with modern schizophrenia is that the voices are almost always hostile and destructive. This may be due to the fact that to a fully conscious modern person, it becomes a struggle for control. The author does mention, though, that in giving talks about his theory, he sometimes encounters ordinary people who admit to him that they often hear voices, and have no problem with this fact. One woman told him that every morning when she does the housework she converses with her dead mother. So apparently there are some closet voice-hearers out there.

It's a very interesting theory, and I'm not sure that my post really does the book justice. Despite the title and length, it really is an easy and fascinating read. While the evidence is far from supplying incontrovertible proof, it is nevertheless well researched, and if nothing else, demonstrates that there was likely some very interesting transition state between when humans were mentally chimplike and when we started thinking like modern humans.

The Songbird Theory of Language Evolution

According to the Songbird Theory of the evolution of language, early humans first learned to sing, and only once they had become skilled at music did they begin to acquire actual language. They functioned much like songbirds, using elaborately crafted songs to attract mates. The more elaborate and complex the song, the greater the level of intelligence demonstrated and the greater the likelihood of attracting a mate. Natural selection would therefore have favored those who could best master complex rules of structure. This is how our ancestors developed the ability to handle the enormous complexities of syntax required to converse in everyday language. After that, it would not have been difficult to start adding meaning to the complex linguistic framework already in place.

Although this theory lacks any real physical evidence, there are a number of things about it that appeal to me. Firstly, I have studied several languages (which seems to be about all I do), and the deeper I get into a language the more amazed I am by its structure. Languages really are amazingly complex, far more so than is necessary for high level communication. (Check out the case system in Latin if you still have doubts.) Linguists are always uncovering new layers of subtlety in language, and there is no real hope that a single language will ever be fully described in all its nuances. If you were to analyze fully any conversation, even by the most uneducated individuals, you could write volumes about the structures that they use. Yet many people blather on endlessly using this immensely complex syntax while actually communicating very little. It's as if the syntax-creating structures in our brains have had far more time to evolve than the parts that convey meaning.

Also, there seems to be a prevailing view among linguists today that language arose suddenly fully-formed with no intermediate stages. This has always seemed ludicrous to me. If that were so, then we should be able to teach chimpanzees to communicate with fully-developed language just like us, if not by speaking, then by typing or signing. (They may be capable of some amazing communication using these methods, but it is not full-blown language, like in Planet of the Apes.) Linguists point to the fact that of all the thousands of languages and dialects spoken throughout the world, ever single one is fully developed and no less expressive than any other language. (Of course each one is specific to its cultural and geographic context.) Well, . . . duh! Obviously full language skills represent such an advantage that humans without such linguistic abilities would have long ago died out or taught themselves to master language. Just because there are no semi-verbal societies in the world today proves nothing. There are also no people in the world today who use stone hand axes, even though they were once commonplace. (We don't even know for certain how they were used, or for what.) The Songbird Theory provides us with an imtermediate step in human language acquisition -- probably one of many.

There is also the fact that music and poetry are universal to all cultures everywhere, without exception. This is interesting, considering that none of the other great apes are at all musically inclined. Music, even that which is accompanied by lyrics, seems to function different neorologically from regular speech. Some people who have suffered a brain injury, as in the case of a stroke, that causes them to lose the power of speech, can still sing perfectly well. So clearly, music is much more than just ornate speech.

For more information on this theory, check out this Discover article, which touches on it. For a more technical paper, go here.

Most Boring Post So Far

As most everyone who reads this already knows, every Tuesday I put up some old college paper of mine, thereby putting it into the public domain in the hopes that someday someone may find a use for it. (That's why people tend to steer clear of my blog on Tuesdays.)

Earlier today I was going through a stack of old floppies, most of which are no longer readable, and I came across the bibliography for my paper on the French subjunctive, which I posted last month. I had feared it was lost forever. Oh happy day!

Anyway, if you want to check it out (and I can't imagine why you would), you can click below to see it. (Hm, tomorrow's pic-of-the-week day; maybe I can post a photo of the bibliography.)

Continue reading "Most Boring Post So Far" »

Aquatic Ape Theory

I've long been a proponent of the Aquatic Ape Theory, and it surprises me that it has never really caught on. Even after reading several criticisms of it with a fairly open mind, it still seems obvious to me that it must be true. I've just finished reading Elaine Morgan's most recent work on the subject -- The Aquatic Ape Hypothesis. In it she details the core arguments of the theory and responds to criticisms of her previous works.

I've wanted to post on this subject for a long time; I was just waiting to acquire and read this book to refresh my memory. Listed below, in no particular order, are the arguments that I find to be the most compelling:


  • We love water. People enjoy going to the beach or a lake. Many have swimming pools behind their houses. And all the finest hotels have a swimming pool. It's not just that we are able to swim. Just about any mammal can do that if it finds itself in deep water. We seem to enjoy it immensely. That would seem to be a very unnatural behavioral trait for a mammal that never had its recent evolution shaped by a dependence on water. Certainly none of the other great apes share this with us. This alone makes the theory plausible.
  • We're blubbery and mostly hairless. All of the larger aquatic mammals have lost their hair, just like us. And I really find it hard to believe that all this hair loss occurred as a result of mastering the use of fire. Even mammals that live in very warm conditions still have their hair. As a modern human with a heated home and access to heated buildings, I still experience plenty of occasions where I become quite cold, and it would be to my advantage to have a thick coating of fur.
  • Human babies are fat, and they rapidly get fatter during the first few months of life. The other ape babies are born scrawny. If a human baby is placed underwater, instead of panicking, it will make its way to the surface, helped by its buoyant fat, and instinctively float on its back with its mouth and nose just above the waterline.
  • Humans dehydrate much faster than other land mammals, and they are unable to store as much reserve moisture in their tissues. That's why doctors are always telling us to drink two liters of water a day. It's as if our ancestors lived most of their lives in a very water-rich environment.
  • There are a number of intriguing human facial features that are not shared by the other apes. Most significant is that our nose juts out with the nostrils pointing downward, so we can submerse our heads underwater without the water instantly pouring into our nasal passages. It works like a diving bell. Also, we can flare our nostrils and make them bigger. This may mean that our ancestors' noses were closed by default and were only opened when their noses were intentionally flared. This is the case with sea lions. And it makes sense that we would quickly have lost this adaptation as soon as we left the water, since it would hinder breathing. Furthermore, humans have much more expressive faces than the other apes, who rely much more on posture and body language. That would make sense if we spent a great deal of time in the water with our bodies submerged and dedicated to the task of staying afloat. In that case, early humans would have to rely much more on facial expression to convey feelings and information.
  • This is not mentioned by Elaine Morgan, but I think it's significant. About a year ago on PBS there was a documentary by a genetic researcher tracing the migration paths of early modern humans. (Sorry, I no longer remember the name of the program.) According to his findings, the first modern humans to settle outside of Africa followed the coastline eastward across Asia and ended up doing a bit of island hopping to reach Australia and Tasmania. What amazed me was that according to the researcher's interpretation of his genetic data taken from modern populations, this migration never strayed far from the coast. These people traveled thousands of miles over thousands of years and only established inland populations in Australia and Tasmania. How and why would they have done that without some sort of previously acquired aquatic adaptations. I realize that these were modern humans, nearly identical to us, and that the aquatic phase occurred and came mostly to an end millions of years ago in the time of Lucy, but it says a lot that early Cromagnons were so dependent on the sea. I should also say that the researcher did not mention the Aquatic Ape Theory.

Of course there are several additional arguments and further data beyond those listed above, but those are the arguments that I find personally to be the most convincing. Coupled with the fact that I can't see anything farfetched or highly implausible about the theory, I find it strange that so few people take it seriously. Much of that may have to do with the fact that Elaine Morgan does not have much in the way of academic credentials, but shouldn't the theory be evaluated based on its own merits and shortcomings rather than who its proponents are?

Books to Read When Pondering the Future of Humanity

The following post is a modified version of a reading list I posted to Amazon some time ago. I found each of these books to be absolutely fantastic. If you're at all interested in pondering the future of humanity, I would highly recommend reading all of them in the order presented here.

A good starting point is The Age of Missing Information. In the early 1990s, author, Bill McKibbon, had an entire day's cable programming recorded. This included 24 hours of each channel, totalling over 1700 hours of broadcasting. Over the following months, he watched it all. This book contains his reflections on what kinds of information television provides us and what it lacks. He compares what we learn from TV to the kind of information he is exposed to on a day of camping in the woods. And he reflects on the differences in the types and quantity of knowledge available to pretelevision generations as opposed to contemporary people, providing a good reflection on where we are today.

Next read Pale Blue Dot: A Vision of the Human Future in Space by Carl Sagan. This book was first published in 1994 but is still very current, because sadly, very little has been done in space since it was written. Sagan is very thorough. He discusses everything that has been achieved thus far in terms of spacetravel and exploration. He speculates about what will be possible in the future and the sorts of technologies that need to be developed. He gives a complete inventory of the solar system, including planets, moons, asteroids, and the Oort Cloud and what they have to offer future space travelers, both in terms of practical uses as well as intriguing unanswered scietific questions. He discusses encountering extraterrestrial life, both intelligent and not as well as travel between the stars in the distant future. There are many interesting tidbits here that you won't find anywhere else.

The third book on this list will absolutely blow your mind. It's The Age of Spiritual Machines: When Computers Exceed Human Intelligence by Ray Kurzweil. It explores the consequences of Moore's law (the observation that computer processing power doubles every 18 months) for the 21st century. Kurzweil argues that not only will computer power continue to increase exponentially throughout the next 100 years, but the rate of increase itself will probably increase. By 2099 there will be no distinction between human and computer intelligences. The vast majority of humanity will inhabit a completely virtual world in which our mental processes are accelerated a millionfold, and everyone is essentially immortal. I know it sounds like another crackpot book, but check it out anyway; the arguments are quite sound, and Kurzweil is a recognized technologist.

The Clock of the Long Now: Time and Responsibility: The Ideas Behind the World's Slowest Computer by Stewart Brand takes a much longer view of the future than Kurzweil. Brand is involved in a project to construct the world's first 10,000 year clock, a timepiece that, with occasional maintenance, will keep time for the next 100 centuries. The rationale is that such a project will influence people to take a much less shortsighted view of the future and consider how actions taken today may impact the distant future. The point is made that the effort required to effect change is usually directly proportional to how far in advance a change is attempted. This is especially relevant to environmental issues.

Now conclude your reading with Reason for Hope: A Spiritual Journey by Jane Goodall. In her latest autobiographical book, Goodall writes that people are often surprised and even skeptical when she tells them that she is hopeful about the future. This book is her answer to them. She reflects on her life from early childhood to her work in Africa, first with Leaky and then on her own, studying and working with chimpanzees, to her current environmental and educational work. She draws on evidence from her life experiences to argue that despite the frightening and precarious state the world is now in, she believes that humanity will ultimately have a bright future. (Why is it that half my posts turn out to be ape-related?)

Also of note is The Transparent Society: Will Technology Force Us to Choose Between Privacy and Freedom? I haven't read it yet, but based on the fact that it's by David Brin and was well-reviewed on Amazon, it's definitely a contender for this list.

On the web you can check out David Brin's essays about the future and Ray Kurzweil's enormous site dedicated to future technologies.

Happy reading!

Incredible Breakthroughs and Discoveries That No One Knows About (part 3)

Anything into Oil:
This is one of those things that's just too good to be true but nevertheless is. Researchers at Changing World Technologies in Philadelphia have refined a process known as thermal depolymerization, which can convert virtually any waste product into "high-quality oil, clean-burning gas, and purified minerals". We could, in theory, produce 4 billion barrels of oil just from our annual (US) agricultural waste production at $8 to $12 a barrel, which would be sufficient to completely end US dependence on foreign oil, while at the same time completely solving our waste problems. The process has no toxic or unusable byproducts at all. Furthermore, since none of the oil and gas generated from this process are taken from belowground carbon deposits (coal and crude oil), the net amount of carbon in the atmosphere would not be increased, and therefore use of the resulting products would not contribute to global warming. (So why has the federal government only contributed $12 million for R&D?)

My favorite line from the article:

If a 175-pound man fell into one end, he would come out the other end as 38 pounds of oil, 7 pounds of gas, and 7 pounds of minerals, as well as 123 pounds of sterilized water.

Quantum Computers:
How they are supposed to work is a bit beyond me, since it is based on quantum physics. But they are coming, and from what I understand, once they're perfected, we can throw Moore's Law right out the window (defenestration). They'll make today's supercomputers look like the abacus. From what little I understand, a functioning quantum computer can not only solve problems that today's machines couldn't even begin to tackle, but they form the solutions to those problems instantly (literally no passage of time). Once a problem is inputed, the quantum state of the processor is unable to exist in our universe in a state other than the one which represents a solution. In other words, its processing speed is infinite. And there is some notion about it existing simultaneously in every other state possible in a multitude of alternate realities. I should stop at this point, since I fear I am beginning to blather incoherently about something of which I have no real understanding. All I really know is that these machines will change the world in ways we can't even begin to imagine.

If you have a larger brain than I and would like to tackle understanding how quantum computers work, check out these links. I've listed them in order of increasing complexity:

Incredible Breakthroughs and Discoveries That No One Knows About (part 2)

Life on Neptune?
Okay, this is extremely speculative, but I think it merits some consideration. In 1994 Carl Sagan wrote the following about the blue coloration of Neptune and Uranus:

Conventional wisdom holds that the absorption by methane and the Rayleigh scattering of sunlight by the deep atmosphere together account for the blue colors on Uranus and Neptune. But analysis of Voyager data be Kevin Baines of JPL seems to show that these causes are insufficient. Apparently very deep--maybe in the vicinity of hypothesized clouds of hydrogen sulfide--there is an abundant blue substance. So far no one has been able to figure out what it might be. Blue materials are very rare in Nature.

(Pale Blue Dot: A Vision of the Human Future in Space)

Sagan is careful not to speculate any further, but I can't help wondering if the blue substance might be oxygen. Oxygen is an extremely rare substance in Nature. The only phenomenon we know of that can create large amounts of it is life, and it doesn't have to be complex multicellular life, either. Simple bacteria could get the job done, and they wouldn't even have to have arisen there. A large comet or asteroid striking the earth billions of years ago would have been capable of sending chunks of bacteria-laden rocks into space where they bacteria would lay dormant until an eventual impact with one of the gas giants. This is not so improbable; bacteria are highly adaptable. In 1969 the Apollo 12 crew recovered a camera left previously by the Surveyor 3 probe, containing living microbes that had "survived launch, space vacuum, 3 years of radiation exposure, deep-freeze at an average temperature of only 20 degrees above absolute zero, and no nutrient, water or energy source." So the discovery of an unexplained blue substance on Neptune certainly does beg the question, yet strangely, it is a question no one seems to be asking. I've checked around on the web, and everyone seems to be giving the same methane-related explanation for the planet's blue color, the one that Sagan specifically stated in the above quotation nearly a decade ago could not account for it. (Examples can be found here, here, and here.) Perhaps some form of Neptunian conspiracy is at work.

Theory of Evolution Confirmed:
Until recently, I was very skeptical of evolutionary theory, not for religious reasons, but rather because it simply sounded farfetched. There is no question that evolution has been occurring; the fossil record is irrefutable. Over millions of years, life adapts to its environment by undergoing changes that eventually give rise to new and, in general, more complex species. My problem was with the mechanism. The idea that the entire process is governed by a combination of chance mutations and the principle of survival-of-the-fittest seemed utterly unbelievable, and there is no way to observe the process directly (at least not until science has been around continuously for a few million years to document it). Furthermore, there is no other known process in the natural world that behaves similarly. In other words, we know it occurs, but the theory as to exactly how it occurs seemed little more than guesswork. Then I learned about genetic algorithms, which are common knowledge only to people involved with Computer Science.

Basically genetic (or Darwinian) algorithms are computer programs that mirror the evolutionary process, as we understand it, to produce the design for a product through generations of simulations or to produce a new computer program. The process begins with a population of simple randomized representations. Each one is tested, and the ones that come closest to whatever the objective is have their traits combined together randomly to form the individuals of the next generation, along with a few random mutations sprinkled in for variety. Then the process is repeated again and again over successive generations. Examples of this are creating programs that allow computer generated characters to move realistically without having all their movements choreographed in advance
and designing robots that can locomote efficiently in the real world. (You can even download the program yourself to evolve your own robots.)

What's so intriguing about genetic algorithms is how accurately they mirror the behavior of evolution as seen in the fossil record. For one thing, there is a huge gain in complexity over the course of many generations. (There is a wonderful demonstration of this phenomenon here.) Also, there is a tendency for periods of stagnation over many generations with very little change, and then suddenly one individual is produced with a mutation that is so advantageous that there is a sudden developmental spurt in the population where the rate of change of the population accelerates tremendously as the new trait is assimilated, improved upon, and combined with new traits. Finally, the end product (the individual of the final generation which most best fulfills the criteria set forth by the programmer) is often of a level of efficiency and elegance that no human programmer or engineer could possibly match, or in many cases, even comprehend. Yes, that's right; using genetic algorithms, it is not at all uncommon for computers today to design/evolve chips that work better than anything a human could design and whose workings are beyond human understanding -- the very same situation we face in the study of biology.

So . . . maybe it's time I rethought my skepticism. It seems as though natural selection and survival-of-the-fittest can, in fact, account for the increasing level of biological complexity observed on the earth over time.

Breaking Ape News

For a blog that's purportedly "about nearly everything", it seems that this is quickly becoming an ape blog. However, I just came across some new (and quite disappointing) information on that CNN story about the newly discovered mystery ape. According to this letter by one of the researchers, the information previously released to the press